BASIC TEXT SEARCH Select your search field from the pull-down menu, enter your search term in the adjacent window and click the "Submit Query" button. The "Mutation Names" search will look for a match in cDNA, protein, or legacy name. You can also search all fields by selecting "All Fields". For advanced search click on the "Advanced Search" button below.

Search:


SEARCH TIPS
  • Search is case insensitive.
  • Search term can consist of a whole word or part of a word e.g.
    • Searching for "551" in the Protein Name field will retrieve all mutations that alter the protein at position 551.
    • Searching for "del" in Mutation Names will retrieve all deletion mutations (but it may take awhile).


cDNA Name Protein Name Legacy Name Region Description Consequence
c.182T>C p.Leu61Pro L61P exon 3 T to C at 314 Leucine to Proline at position 61
c.262_263delTT p.Leu88IlefsX22 394delTT exon 3 deletion of TT from 394 frameshift
c.264_268delATATT p.Leu88PhefsX21 exon 3
c.274G>A p.Glu92Lys E92K exon 4 G to A at 406 Glu to Lys at 92
c.274G>T p.Glu92X E92X exon 4 G to T at 406 Glu to Stop at 92
c.280_286delACCAAAG p.Thr94GlnfsX11 412del7- >TA exon 4 deletion of ACCAAAG from 412 and insertion of TA frameshift
c.303_304insA p.Leu102ThrfsX9 435insA exon 4 insertion of A after 435 frameshift
c.310delA p.Arg104GlufsX3 441delA exon 4 deletion of A at 441 and T to A at 486 frameshift
c.313delA p.Ile105SerfsX2 444delA exon 4 deletion of A at 444 frameshift
c.326A>G p.Tyr109Cys Y109C exon 4 A to G at 458 Tyr to Cys at 109
c.328delG p.Asp110ThrfsX14 460delG exon 4 deletion of G at 460 frameshift
c.343_345del p.Glu115del [delta]E115 exon 4 3 bp deletion of 475- 477 deletion of Glu at 115
c.346G>A p.Glu116Lys E116K exon 4 G to A at 478 Glu to Lys at 116
c.350G>C p.Arg117Pro R117P exon 4 G to C at 482 Arg to Pro at 117
c.393delT p.Phe131LeufsX3 525delT exon 4 deletion of T at 525 frameshift
c.409delC p.Leu137SerfsX16 541delC exon 4 deletion of C at 541 frameshift
c.409_412delCTCC p.Leu137TyrfsX15 541del4 exon 4 deletion of CTCC from 541 frameshift
c.416A>G p.His139Arg H139R exon 4 A to G at 548 His to Arg at 139
c.416A>T p.His139Leu H139L exon 4 A to T at 548 His to Leu at 139
c.418C>T p.Pro140Ser P140S exon 4 C to T at 550 Pro to Ser at 140
c.420_421insA p.Ala141SerfsX18 552insA exon 4 insertion of A after 552 frameshift
c.424delA p.Ile142PhefsX11 556delA exon 4 deletion of A at 556 frameshift
c.446G>T p.Gly149Val G149V exon 4 G to T at 578 Gly to Val at 149
c.455T>G p.Met152Arg M152R exon 4 T to G at 587 Met to Arg at 152
c.459_476delAATAGCTATGTTTAGTTT p.Ala155_Ile160del 591del18 exon 4 deletion of 18 bp from 591 deletion of 6 a.a. from
c.489G>A 621G- >A exon 4 G to A at 621 mRNA splicing defect
c.1220_1239delAATTATTTGAGAAAGCAAAA p.Glu407AlafsX4 exon 10
c.2909G>A p.Gly970Asp G970D exon 18 G to A at 3041 Gly to Asp at 970
c.(?_274)_(743_?)del Del exon 4- 6a exon 4 - exon 6 Deletion of exons 4, 5, 6a Predicted truncation of the CFTR protein in TM1.




Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011