Mutation Details for c.2479G>T
|
|
cDNA Name
|
c.2479G>T
|
|
Protein Name
|
p.Glu827X
|
|
Exon or Intron
|
exon 14
|
|
Legacy Exon or Intron
|
exon 13
|
|
|
E827X
|
|
Other Details
|
The nucleotide change was found by using DGGE and direct sequencing of the PCR product showing an altered mobility in the gel. It was observed once among 50 CF chromosomes and is carried on a C haplotype. Clinical data in that family may potentially be of interest because there were four affected male children (genotype [delta]F508/G827X) with a severe form of the disease. Three are still alive and have developed cirrhosis in the first years of their life.
The G827X destroys two MboII site in the normal sequence so PCR product obtained using TCAATCCAATCAACTCTATACGA and ATCATAGGATTAGGATAAGGTGTA as primers leads to (291+110+81+12+3) for the normal sequence and (291+125+81) for the mutated one after MboII digestion.
|
|
Contributors
|
Audrezet MP,
Guillermit H,
Mercier B,
Quere I,
Verlingue C,
Ferec C
1991-12-06
|
|
Institute
|
Centre de Transfusion Sanguine et de Biogenetique
Brest, France
|
|
Submitted Phenotype Details
|
The deceased French CF patient (male) carried deltaF508 on the other allele. (pers.corr. Ferec)
|
|
Reference
|
Férec et al. 1991
|
To check if there are any papers published about this mutation/variant on PubMed, please click here.
|
|
|
|
|
