|
cDNA Name
|
c.1220_1239delAATTATTTGAGAAAGCAAAA
|
|
Protein Name
|
p.Glu407AlafsX4
|
|
Exon or Intron
|
exon 10
|
|
Other Details
|
|
|
Contributors and Institutes
|
| Hantash | - | Quest Diagnostics Nichols Institute | | Rebuyon | - | Quest Diagnostics Nichols Institute | | Peng | - | Quest Diagnostics Nichols Institute | | Redman | - | Quest Diagnostics Nichols Institute | | Sun | - | Quest Diagnostics Nichols Institute | | Strom | - | Quest Diagnostics Nichols Institute |
|
|
Submitted Phenotype Details
|
The proband is a 19 year old caucasian female with clinical symptoms of classic CF and sweat chlorides of 90 and 87 mmol/L.
The patient harbors a large deletion of exon 4-10 on one allele, and a novel 20 bp deletion in exon 7 on the second allele
|
|
Reference
|
|