Mutation Details for c.720_741delAGGGAGAATGATGATGAAGTAC

cDNA Name c.720_741delAGGGAGAATGATGATGAAGTAC 
Protein Name p.Gly241GlufsX13 
Exon or Intron exon 6 
Legacy Exon or Intron exon 6a 
Legacy Name 852del22 
Other Details This is a frameshift mutation in exon 6A due to a deletion of 22bp, starting wtih bp 852. The mutation (del22bp852) was found in a single individual that has F508 on the other chromosome. 
Contributors Dean M, Belle White M, Gerrard B   1990-09-30
Institute National Cancer Institute Frederick, MD, USA 
Phenotype Information CFTR2
Reference Dean et al. 1992 

To check if there are any papers published about this mutation/variant on PubMed, please click here.




Comments or questions? Please email to cftr.admin
The Database was last updated at Apr 25, 2011