CF Genetic Analysis Consortium NEWSLETTER #67- January 5, 1996
HAPPY NEW YEAR!
1. The total number of mutations reported is 583, DNA sequence polymorphisms in the coding region is 63, and, non-coding region, 53 (see the entire lists in the attached tables). Summary of the newly reported CF mutations and DNA sequence polymorphisms:
Name of Nucleotide Exon Consequence Institute Names of
mutation change Contributors
A1364V C->T at 4223 22 Ala->Val at 1364 Institut de Claustres M,
CBAVD Biologie Carles S,
Montpellier Desgeorges M
(Jul 19)
Note: The above mutation was found by DGGE then direct sequencing of a CBAVD patient from
Southern France. Contact: Pr. Mireille Claustres
W882X G->A at 2777 14b Trp->Stop at 882 Centre de Férec C, Mercier
Transfusion B, Quere I,
Sanguine et de Lissens W,
Biogénétique, Bonduelle M,
Brest, France Liebaers (Jul 26)
Note: The above mutation was found on one CF chromosome in a patient of Belgian origin by
DGGE screening and DNA sequencing. Contact: Dr. Claude Férec
3041-1G->A G->A at 3041-1 intron mRNA splicing Royal Manchester Malone G,
15 mutation Children's Hawworth A,
Hospital, England Schwarz M (Aug 3)
Note: The above mutation was detected by SSCP/heteroduplex analysis and identified by
direct DNA sequencing. The mutation was found in a 4-year old female CF patient whose
other mutation is [[Delta]]F508. 3041-1G->A was seen only once in 80 non-[[Delta]]F508
chromosome screened. Contact: Dr. Martin Schwarz
711+3A->T A->T at 711+3 intron mRNA splicing IRO, Spain Casasl T, Ramos
5 mutation? MD, Gimenez J,
Nunes V,
Estivill X (Aug
3)
G85V G->T at 386 3 Gly->Val at 85 as above as above
Note: The above 2 mutations were detected by DGGE and identified by direct sequencing.
711+3A->T was found in a Spanish woman with PS, carrying R334W in the other chromosome, and
with 2 brothers died of CF. Screening in 132 CF patients was negative. The patient with
G85V carried G542X on the other chromosome, and presented mild phenotype with PI. Contact:
Dr. Teresa Casals
D993Y G->T at 3109 16 Asp->Tyr at 993 Institut de Claustres M,
Biologie Desgeorges M,
Montpellier Carles S (Aug 4)
Note: The above mutation was found by DGGE and then direct sequencing of DNA from a
patient with severe phenotype from Southern France. Contact: Pr. Mireille Claustres
1283delA deletion of A 8 frameshift Groupe Bienvenu T,
at 1283 Hospitalier Bousquet S,
Cochin, Paris Beldjord C,
Kaplan JC (Aug 7)
Note: The above mutation was detected by DGGE using chemical clamps and identified by
direct sequencing. It is not found in 100 other non-[[Delta]]F508 CF chromosomes and 100
non-CF chromosomes tested. The patient has [[Delta]]F508 on the other chromosome, a
pancreatic deficiency and lung disease. Contact: Thierry Bienvenu
Q98X C->T at 424 4 Gln->Stop at 98 Royal Manchester Urion A, Malone
(Pakistani Children's G, Hawworth A,
specific?) Hospital, England Schwarz M (Aug
14)
Note: The above mutation was detected by SSCP/heteroduplex analysis and identified by
direct DNA sequencing. The mutation was found in homozygous form in 3 apparently unrelated
Pakinstani CF patients. Q98X was seen 3 times (although in homozygous form) among 20
Pakistani CF chromosomes. The first of these was from the North-West and the other 2 were
referred by the West Midlands Regional Genetics Service at Birmingham. Contact: Dr. Martin
Schwarz.
3154delG deletion of G 17a frameshift Groupe Bienvenu T,
at 3154 Hospitalier Bousquet S,
Cochin, Paris Herbulot C,
Beldjord C,
Kaplan JC (Aug
14)
Note: The above mutation was detected by DGGE using chemical clamps and identified by
direct sequencing. It is not found in 100 other non-[[Delta]]F508 CF chromosomes and 100
non-CF chromosomes tested. The patient has R553X on the other chromosome, a pancreatic
deficiency and moderate lung disease. Contact: Thierry Bienvenu
Y563C A->G at 1821 12 Tyr->Cys at 563 Princess Delhaize C (Aug
Margaret 22)
Hospital for
Children
The above mutation was detected by SSCP and identified by direct sequencing. The mutation
destroys an AccI site which was used for confirmation. Contact: Dr. E. Edkins
3272-9A->T A->T at 3272-8 17a mRNA splicing Laboratoire de Chomel J-C,
mutation? Génétique Baudis M, Kitzis
Cellulaire et A (Aug 23)
Moléculaire,
Poitiers, France
Note: The above mutation was detected by DGGE using chemical clamp and characterized by
direct sequencing. Possible consequence on RNA splicing has to be examined. Contact:
Jean-Claude Chomel
Y304X C->G at 1044 7 Tyr->Stop at 304 Centre de Férec C, Mercier
Transfusion B, Quere I (Aug
Sanguine et de 29)
Biogénétique,
Brest, France
Note: The above mutation was found on a CF chromosome in a patient of French origin by
DGGE and DNA sequencing. It was also found in the same family by V. Dumur and G.
Lalau-Lille. Contact: C. Férec
297-2A->G A->G at 297-2 intron mRNA splicing Royal Manchester Schwarz M,
2 mutation Children's Hawworth A,
Hospital, England Malone G (Sep 4)
1717-2A->G A->G at 1717-2 intron mRNA splicing as above Hawworth A,
10 mutation Schwarz M,
Malone G (Sep 4)
Note: The above 2 mutations were detected by SSCP/heteroduplex analysis and identified by
direct DNA sequencing. 297-2A->G was found in a male CF patient (referred by Dr. J. Harvey
of Salisbury, England) whose other mutation is [[Delta]]F508. 1717-2A->G was found in a
male CF patient of Romanian origin (referred by Prof. I. Popa of Timisoara, Romania) whose
other mutation is [[Delta]]F508. 297-2A->G and 1717-2A->G were each seen only once in over
100 non-[[Delta]]F508 CF chromosomes screened. Contact: Dr. Martin Schwarz.
-33G->A G->A at -33 5'upst promoter mutation? Institut de Claustres M,
ream Biologie Carles S,
Montpellier Desgeorges M
(Sep 8)
Note: The above mutation was found by DGGE and then direct sequencing of the DNA from a
patient with CBAVD from Southern France. This change was not seen in any of the normal
alleles in the study. Contact: Mireille Claustres
Q1144X C->T at 3562 18 Gln->Stop at 1144 Royal Manchester Schwarz M,
Children's Hawworth A,
Hospital, England Malone G (Sep 4)
Nore: The above mutation was detected by DGGE analysis and identified by direct DNA
sequencing. The mutation was found on the same chromosome carrying R75Q, in a male CF
patient whose other mutation is [[Delta]]F508. Q1144X was seen only once in over 150
non-[[Delta]]F508 chromosomes screened. The DGGE primers were supplied by Prof. Michel
Goossens on behalf of the European Community Concerned Action for the Co-ordination of
Cystic Fibrosis Research and Therapy. Contact: Dr. Martin Schwarz.
1161insG insertion of 7 frameshift Virchow-Klinikum, Varon R, Reis A
G after 1161 Berlin (Sep 21)
Note: The above mutation was identified by SSCP followed by direct sequencing in a German
CF patient with [[Delta]]F508 on the other chromosome. The mutation was not found on 47
other non-[[Delta]]F508 CF chromosomes. Contact: Dr. med. André Reis
3121-1G->A G->A at 3121-1 intron mRNA splicing Hôpital Feldmann D,
16 mutation D'Enfants Fontaine J-L,
Armand-Trousseau Magnier C,
Chauve C,
Plouvier E,
Aymard P (Sep 22)
Note: The above mutation was detected by DGGE and direct sequencing. It was found in a
Jewish family in France. The patient is pancreatic inssufficient, with the other CF allele
being W1282X. Contact: Delphine Feldmann. 3121-1G->A was also found in a fetus at 14
weeks of gestation by Dr. Claude Férec (Oct 10); the fetus was said to be affected with the
other mutation being [[Delta]]F508.
1243ins6 insertion of 7 insertion of Asp Institute of Shackleton S,
ACAAAA after and Lys after Molecular McDowell T,
1243 Lys370 Medicine, Oxford Harris A (Oct 4)
Note: The above mutation was detected by SSCP analysis of exon 7. Contact: Ann Harris
V562I G->A at 1816 12 Val->Ile at 562 Hôpital Feldmann D,
(also reported as D'Enfants Balloul H,
a polymorphism by Armand-Trousseau Magnier C,
Fanen et al. 1992) Chauve C,
Plouvier E,
Aymard P (Oct 4)
4375-15C/T C or T at intron polymorphism as above as above
4375-15 23
Note: V562I was detected by DGGE and direct sequencing. The patient was born in Morocco
and is homozygous for the mutation and reported to have severe CF with pancreatic
insufficiency. Contact: Dr. Delphine Feldmann.
L320V T->G at 1090 7 Leu->Val at 320 Groupe Bienvenu T,
CAVD Hospitalier Bousquet S,
Cochin, Paris Herbulot C,
Beldjord C,
Kaplan JC (Oct 6)
Note: The above mutation was detected by DGGE using chemical clamps and identified by
direct sequencing. It is not found in 100 other non-[[Delta]]F508 CF chromosomes and 100
non-CF chromosomes tested. The patient is presented with congenital absence of vas
deferece and has [[Delta]]F508 on the other chromosome. Contact: Thierry Bienvenu
657delA deletion of A 5 frameshift Royal Manchester Malone G,
at 657 Children's Hawworth A,
Hospital, England Schwarz M (Oct
11)
Nore: The above mutation was detected by DGGE analysis and identified by direct DNA
sequencing. The mutation was found on the same chromosome carrying 406-6T->C, in a male CF
patient whose other mutation is 1154insTC. 657delA was seen only once in over 200
non-[[Delta]]F508 chromosomes screened. The DGGE primers were supplied by Prof. Michel
Goossens on behalf of the European Community Concerned Action for the Co-ordination of
Cystic Fibrosis Research and Therapy. Contact: Dr. Martin Schwarz.
E822X C->T at 2596 13 Glu->Stop at 822 Athens Tzetis M,
University, Antoniadi T,
Greece Kanavakis E (Oct
11)
Note: The above mutation was detected by DGGE and confirmed by direct sequencing. It was
found in 4 of 572 CF chromosomes screened (0.84%). The genotypes of the 4 Greek patients
are: [[Delta]]F508/E822X, 3272-26A->G/E822X, 621+1G->T/E822X and E822X/?. Contact: Dr.
med. E. Kanavakis
CF40kbdel(?) deletion of 4-10 large deletion Yorkshire Logan WP, Taylor
exons 4-10 from intron 3 to Regional GR (Oct 16)
intron 10 Laboratory
Note: The above mutation was detected as a null PCR product for exons 4, 7, IVS8(CA)n and
exon 10 in a consangineous Pakistani pedigree. Positive PCR products were detected for
exons 3, 11 and IVS17b(TA)n. The limits of the deletion have not yet been defined. It may
be the same as that described by Chevalier-Porst & Bozon in NL#66. The mutation name
assignment is therefore provisional. Contact: Dr. G.R. Taylor
3153delT deletion of T 17a frameshift Laikon General Balassopoulou A,
at 3152 or Hospital, Greece Hatzipangiotou N
3153 (Nov 2)
Athens Tzetis M,
University, Antoniadi T,
Greece Kanavakis E (Dec
14)
Note: The above mutation was identified by DGGE and direct sequencing on the paternal CF
chromosome of a patient whose other chromosome carries N1303K. It was found once among the
80 CF chromosomes screened for mutations in exon 17a. Contact: Dr. Angeliki Balassopoulou.
This mutation was also independently reported by Tzetis et al. as 3152delT, in a 3-year old
patient with PI, sweat Cl of 92.2mEq/L and moderate lung disease; the associated haplotype
is 16-31-27 (IVS8CA-17BTA-17BCA); [[Delta]]F508 was found on the other chromosome with
haplotype of 17-31-13. Contact: Dr. Emmanuel Kanavakis.
G576X G->T at 1858 12 Gly->Stop at 576 Hôpital Henri Girodon E,
Mondor, Creteil, Costes B,
France Cazeneuve C,
Ghanem N,
Goossens M (Nov
10)
M952I G->C at 2988 15 Met->Ile at 952 as above as above
CBAVD mutation?
Note: The above 2 mutations were discovered by DGGE and identified by direct sequencing.
G576X was found in a 4-year old Romanian patient who has severe pulmonary infection since
the age of 18 months; the other mutation for this patient is unknown. M952I was found in a
CBAVD patient who also carries R117H but it was unclear if the 2 mutations were located on
different chromosomes due to the lack of family members. Other CFTR gene regions also
remain to be examined. The mutation status of M952I is thus tentative. Contact: Prof.
Michel Goossens.
E826K G->A at 2608 13 Glu->Lys at 826 Institute of Bombieri C,
Biology and Benetazzo MG,
Genetics, Saccomani A,
Verona, Italy Pignatti PF (Dec
5)
Note: The above sequence alteration was found by DGGE analysis of a sarcoidosis patient.
It was sequenced and confirmed with a Restriction site Generating PCR assay. It was absent
by DGGE analysis in 208 control chromosomes, and by sequencing 60 chromosomes with unknown
CFTR mutations. Contact: Dr. Cristina Bombieri.
[[Delta]]L453 deletion of 3 9 deletion of Leu Medizinische Dörk T, Skawran
bp between at 452 or 454 Hochschule B, Antonin W,
1488 and 1494 Hannover, Germany Ebhard M, Stegh
A, Ellemunter H,
Schmidtke J,
Stuhrmann M (Dec
7)
Y577F A->T at 1862 12 Tyr->Phe at 577 as above as above
1874insT insertion of 12 frameshift as above as above
T between
1871 and 1874
3425delG deletion of G 17b frameshift as above as above
at 3425 or
3426
492G/A G->A at 492 4 polymorphism as above as above
(Ala120 no change)
Note: [[Delta]]L453 (or 454) was identified in an Austrian CF family from Tyrol. The male
patient had severe CF and carrier [[Delta]]L453 on his maternal and [[Delta]]F508 on the
paternal allele. Mutation Y577F and 1874insT were found together in another CF patient
from Austria; this boy is also heterozygous for [[Delta]]F508. 3425delG was identified in
a German CF family from lower Saxonia; the affected girl crried 3425delG on her paternal
and [[Delta]]F508 on the maternal allele. The sequence variant 492G/A was seen once in a
CBAVD patient with yet unknown CFTR mutations. Contact: Dr. med. Manfred
Stuhrmann-Spangenberg.
L1065R T->G at 3326 17b Leu->Arg at 1065 Institut de Casals T, Ramos
Recerca MD, Gimenez J,
Oncologica, Spain Nunes V,
Estivill X (Dec
12)
2790-108G/C G->C at intron polymorphism as above Casals T, Ramos
2790-108 14b MD, Gimenez J,
Nunes V, Bal J,
Mazurczak T,
Estivill X (Dec
12)
Note: L1065R was observed by direct sequencing after detection of an abnormal DGGE
pattern. The CF patient is a 6-year old girl with PI, carrying [[Delta]]F508 mutation in
the other chromosome. The G->C polymorphism at 2790-108 was similarly detected in a Polish
CF patient. Contact: Teresa Casals
156G/A G->A at 156 exon 1 polymorphism Institut de Claustres M,
(Lys8 no change) Biologie Romey M-C,
Montpellier Desgeorges M
(Dec 13)
Note: The above polymorphism which destroys a HaeIII restriction site was detected by DGGE
and direct sequencing of the normal chromosome of the mother of a CF patient from Lebanon.
This change was not found in the normal alleles from Southern France. Contact: Pr.
Mireille Claustres.
3041-52C/G C->G at intron polymorphism Athens Tzetis M,
3041-52 15 University, Antoniadi T,
Greece Kanavakis E (Dec
14)
Note: The above sequence alteration was found once among 500 CF chromosomes screened.
Contact: Dr. Emmanuel Kanavakis.
G392A T->C at 1307 8 Gly->Ala at 392 Groupe Bienvenu T,
CAVD Hospitalier Bousquet S,
Cochin, Paris Herbulot C,
Beldjord C,
Kaplan JC (Dec
15)
1296G/T G->T at 1296 8 polymorphism as above as above
(Thr388 no change)
T1086I C->T at 3389 17b Thr->Ile at 1086 as above as above
Note: The above 3 sequence alterations were detected by DGGE using chemical clamps and
identified by direct sequencing. G392A was found in a patient presented with congenital
absence of vas deferece and [[Delta]]F508 on his other chromosome; it was not found in 100
other non-[[Delta]]F508 CF chromosomes and 100 non-CF chromosomes tested. The G->T
polymorphism was detected in a non-CF subject. T1086I was found in a 34-year old, CF adult
female patient with PI, moderate pulmonary disease and sweat Cl of 113 mEq/L and unknown
CFTR mutation on her other chromosome; it was not found in 200 other non-[[Delta]]F508 CF
chromosomes and 200 non-CF chromosomes tested. Contact: Thierry Bienvenu
132C->G C->G at 132 1 altered Institut de Claustres M,
transcription Biologie Desgeorges M,
rate? Montpellier Romey M-C (Dec
22)
T582I C->T at 1877 12 Thr->Ile at 582 as above as above
15G/A G->A at 15 1 polymorphism? as above as above
Note: The C->G change at 132 destroys an NlaIII restriction site. Contact: Pr. Mireille
Claustres.
L127X T->G at 512 4 Leu->Stop at 127 Centre de Férec C,
Transfusion Verlingue C.
Sanguine et de Mercier B,
Biogénétique, Quéré, I (Dec 27)
Brest, France
Note: The above mutation was found once by DGGE and DNA sequencing. Contact: Dr. Claude
Férec.
2. D. Hughes, A. Hill, and C. Graham (Oct 3) noted with apology that the previously reported mutation S10R did not exist; it was a sequencing artifact corresponding to a G to C change of the 129G/C polymorphism associated with R117H.
3. There were a number of reports on "novel" mutations which had been discribed earlier as polymorphisms. Except for V562I, the others were not printed in the above table as there was no good evidence for disease-causing. Consortium members please check the polymorphism summary tables as well when reporting mutations.
4. Dr. Dieter Gruenert of University of California at San Francisco has sequenced almost 3 kb of intron 9 just upstream of exon 10. He has indicated a willingness to share his sequence with Consortium members. More important, a number of errors in the sequence published by J. Zielenski et al. in their 1991 Genomics paper has been noted by Gruenert and Zielenski, as shown below:
746 790
GUENERT: CAACTGTTAGCTGTTACTAACCTTTCCCATTCTTCCTCCAAACC
GENOMICS: C ACTG TAGCTG TACT ACC TT CCA TC TCCT C AACC
1525-307 1525-274
811 820
GUENERT: TGTGCCCCTT
GENOMICS: TGTGCCC TT
1525-253 1525-245
1541 1550
GUENERT: AAACGTCCTC
GENOMICS: AAACGTC TC
1716+285 1716+295
1571 1580
GUENERT: GCATATAAGT
GENOMICS: GCATATA GT
1716+315 1716+323
Since the above segments were towards the end of the published sequence, consortium members might have not been able to design PCR primers from that region of the intron. Zielenski et al. wish to send their apology.
Please contact Dr. Gruenert for the entire unpublished sequence: 203 Surge, Box 0911, Cardiovascular Research Institute, Gene Therapy Core Center, School of Medicine, University of California, San Francisco, CA 94143-0911, USA. Telephone: (415) 476-7934; Fax: (415) 476-9749; e-mail: <gruenert@labmed.uscf.edu>
5. You can access the CF Mutation Database via the World Wide Web; the address is <http://genet.sickkids.on.ca/cftr/>. As we discussed at the last Consortium meeting at the American Society of Human Genetics meeting in Minneapolis, the database is now widely accessible by the public. The information should therefore be updated as much as possible. Please let me know of any inaccuracy in the summary tables and any revised references. I have also been able to send the Newsletter out by e-mail to about 20 members of the Consortium, saving me about $100 of postage. Half of these members responded the next day saying that everything was properly received but some members had trouble reading the attached files. Since the tables were generated by a Macintosh computer, even though with an interchangeable format, it may be problematic for IBM PC users. ASCI files will loose the format. But, I will find a way to solve the problem. Please send me your e-mail address so that we can save more money in the future. A list of consortium members will be posted shortly.
6. Please drop me note by e-mail if you have seen the www page and give me any suggestions regarding future improvements. My new address is <lctsui@genet.sickkids.on.ca> although the old one should still work.
Regards,
Contacts:
Dr. Angeliki Balassopoulou; Address: Center if Thalassemias, Unit of Prenatal Diagnosis, 16 Sevastoupoleos Street, Ampelokipi 11526, Athens, Greece; Telephone: +30 1-77.89.476 ; FAX: +30 1-77.57.442
Dr. Thierry Bienvenu, Laboratoire de Biochemie Génétique, Groupe Hospitalier Cochin, 27, rue du fg Saint-Jacques, 75679 Paris Cedex 14, France. Telephone: +33 (1) 42 34 12 12; FAX: +33 (1) 44 41 15 22
Dr. Cristina Bombieri; Address: Istituto di Biologia e Genetica, Università di Verona, Strada Le Grazie 8, 37134 Verona, Italy; Telephone: +39 45 8098183; FAX: +39 45 8098180; e-mail: cristy@borgoroma.univr.it
Dr. Dominique Bozon; Address: Biochimie Bât D, Hôpital Debrousse, 29 rue Soeur Bouvier, 69322 Lyon, Cedex 05, France; Telephone: +33 72.38.57.21; FAX: +33 72. 38.58.84
Dr. Jean-Claude Chomel; Address: Centre Hospitalier Universitaire de Poitiers, Hôpital Jean-Benard- La Milétrie- BP 577-86021, Pointiers Cedex; Telephone: +33 49.44.39.03 /57.94 /57.95; FAX: +33 49.44.39.12
Pr. Mireille Claustres; Address: Laboratoire de Biochimie Génétique, Institut de Biologie, Boulevard Henri IV, 34060 Monpellier Cedex, France; Telephone: +33 67 60 11 81; FAX: +33 67 60 95 06; E-mail:
Dr. Harry Cuppens; Address: Center for Human Genetics, University of Leuven, Campus Gasthuisberg, Herestraat 49, B-3000 Leuven, Belgium Telephone: +32 16-34.58.60; FAX: +32 16-34.59.97; E-Mail: Harry=Cuppens%COM%CME@cc3.kuleuven.ac.be
Dr. Garry R. Cutting; Address: Center for Medical Genetics, 600 N. Wolfe Street, CMSC 1004, Baltimore, MD 21287-3914; Telephone: +1 (410) 614-0211; FAX: +1 (410) 955-0484; e-mail: mmacek@welchlink.welch.jhu.edu
Dr. Ângela Duarte; Address: Departmento de Genética Humana, Instituto Nacional de Saúde, Av. Padre Cruz, 1699 Lisboe Codex, Portugal; Telephone: 351.1.7585129; FAX: 351.1.7590441
Dr. Ted Edkins, Clinical Chemistry, Princess Margaret Hospital for Children, Australia; Telephone: +61 9 340 8595; FAX: +61 9 340 8117; e-mail: margchld@angis.su.oz.au
Dr. Delphine Feldmann; Address: Laboratoire de Biochimie, Hôpital D'Enfants Armand-Trousseau, 26 avenue du Dr Arnold-Netter, 75571 Paris Cédex 12, France; Telephone: +33 44.73.68.67; FAX: +33 44.73.66.87
Dr. Claude Férec; Address: Centre de Biogénétique, Centre de Transfusion Sanguine et de Biogénétique, 46 Rue Félix Le Dantec - B.P. 454 - 29275 BREST Cédex, France; Telephone: +33 98.44.50.64; FAX: +33 98.43.05.55; e-mail: Claude.Ferec@univ-brest.fr
Pr. Damjan Glavac; Address: National Institute of Chemistry, SI-61115 Ljubljana, Hajdrihova 19, Slovenia, P.O.B. 30; Telephone: (+386 61) 123-20-61; FAX: (+386 61) 125-92-44/125-70-69
Prof. Michel Goossens; Address: INSERM U.91, CHU Henri Mondor, 51 Av. du Maréchal de Lattre de Tassigny, 94010 CRETEIL, France; Telephone: +33 (1) 49 81 28 60; FAX: +33 (1) 49 81 28 42
Laurent Gouya; Address: Laboratoire de Biochemie Génétique, Hôpitaux Robert Debré, 48, Bd Sérurier, 75019 Paris; Telephone: + 33 (1) 40.03.20.00; FAX: (1) 40.03.20.20
Dr. Ann Harris, Institute of Molecular Medicine, Oxford; e-mail: aharris@molbiol.ox.ac.uk
Dr. David Hughes; Address: Department of Medical Genetics, Floor A, Belfast City Hospital, Lisburn Road, Belfast BT9 7AB Telephone: (0232) 329241; FAX: (0232) 236911
P Jézéquel/Y.E. le Gall; Address: Départment de Biochimie et Biologie Molecularie, Universite de Rennes I, 2 Avenue du Professeur Léon Bernard, 35043 Rennes Cédex, France; Telephone: 33.99.33.68.20; FAX: 33.99.33.68.98; E-Mail: legall@univ-rennes1.fr
Dr. med. Emmanuel Kanavakis; Address: Anthens University, First Dept. of Pediatrics, Unit of Molecular Medicine, St. Sophia Children's Hospital, Athens 11527, Greece; Telephone/FAX: (031) 7795762; E-Mail: ekanavak@atlas.uoa.ariadne-t.gr
Dr. Jean Claude Kaplan; Address: Laboratoire de Biochemie Génétique, Groupe Hospitalier Cochin, 27 rue de fg Saint-Jacques, 75679 Paris Cedex 14; Telephone: +33 (1) 42.34.12.12; FAX: +33 (1) 44.41.15.22
Prof.dr. Radovan Komel ; Address: Institute of Biochemistry, Medical Faculty, Vrazov trg2, 61000 Ljubljana, Slovenia; Telephone: (+386 61) 312 357; FAX: (+386 61) 132 0016
Prof. Inge Liebaers; Address: Center for Medical Genetics, Free University Hospital Brussels, Laarbeeklaan 101, 1090 Brussels, Belgium; Telephone: +32 (02) 477.60.71; FAX: +32 (02) 477.58.00
Dr. Virginia Nunes / Teresa Casals; Address: Institut de Recerca Oncologica, Hospital Duran i Reynols, Autovia de Castelldefels km. 2.7, Hospitalet, 08907 Barcelona, Catalunya, Spain; Telephone: (34-3) 335 71 52; FAX: (34-3) 263 22 51; E-Mail: vnunes@gm.iro.es
Dr. med. André Reis; Adress: Virchow-Klinikum, Augustenburger Platz 1, 13353 Berlin; Telephone: +49 (030) 450 66113; FAX (030) 450 66904; e-mail reis@ukrv.de
Dr. Martin Schwarz; Address: Regional Molecular Genetics Laboratory, Royal Manchester Children's Hospital, Hospital Road, Pendlebury, Manchester M27 4HA; Telephone: 0161-794 4696; FAX: 0617272328
Dr. med. Manfred Stuhrmann-Spangenberg; Address: Institut für Humangenetik OE 6300, Zentrum Kinderheilkunde und Humangenetik, Medizinische Hoschule Hannover, D- 30625 Hannover, Germany; Telephone: +49 (511) 532-3719; FAX: +49 (511) 532-5865
Dr. G.R. Taylor, Yorkshire REgional DNA Laboratory, Clinical Genetics Unit, Ashley Wing, St. Jame's University Hospital, Leeds LS9 7TF; Telephone +44 (0113) 283 7083; FAX: (0113) 246 7090; e-mail: gtaylor@hgmp.mrc.ac.uk
Dr. Lap-Chee Tsui; Address: Department of Genetics, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario, M5G 1X8 CANADA; Telephone: +1 (416) 813 6015 FAX: +1 (416) 813 4931; E-Mail: lctsui@genet.sickkids.on.ca
Andrew Wallace; Address: Regional Molecular Genetics Laboratory, Department of Medical Genetics, St. Mary's Hospital, Hathersage Road, Manchester M13 0JH; Telephone: 061-276-6129/6122; FAX: 061-274-3159
Dr. Julian Zielenski; Address: Department of Genetics, The Hospital for Sick Children, 555 University Avenue, Toronto, Ontario, M5G 1X8 CANADA; Telephone: +1 (416) 813 6365 ; FAX: +1 (416) 813 4931; E-Mail: julian@genet.sickkids.on.ca