TO: MEMBERS OF THE CYSTIC FIBROSIS GENETIC ANALYSIS CONSORTIUM
Amos, Boston U, USA Jaume-Roig, Son Dureta, Spain
Anvret, Stockholm, Sweden Kalaydjieva, Sofia, Bulgaria
Barker, U Alabama Birm, USA Kant, U Penn, USA
Barton, Cambridge, England Kitzis, CHU-Paris, France
Beaudet, Baylor, USA Klinger, Integ Genet, USA
Baranov, Leningrad, USSR Komel, Ljubljiana, Yugoslavia
Boué, Paris, France Knight, London, England
Cao, U Cagliari, Italy Krueger, Hahnemann, USA
Carbonara, Torino, Italy Lavinha, Lisboa Codex, Portugal
Cassiman, U Leuven, Belgium Lissens, Vrije U Brussels, Belgium
Claustres, Montpellier, France Loukopoulos, Athens, Greece
Cochaux, Brussels, Belgium Lucotte, College de France
Collins, U Michigan, USA Malcolm, ICH-London, England
Coskun, Hacettepe U, Turkey Malik, Basler-Basel, Switzerland
Coutelle, East Berlin Mao, Collab Res, USA
Cutting, Johns Hopkins, USA McIntosh, WGH-Edinburgh, Scotland
Dallapiccola, Roma, Italy Morel, Lyon, France
De Arce, Dublin, Ireland
Morgan, McGill, Canada
de la Chapelle, Helsinki, Finland Nukiwa, Tokyo, Japan
Dean, NCI Frederick, USA Olek, U Bonn, West Germany
Desnick, Mount Sinai, New York, USA Orr, U Minnesota, USA
Edkins, Perth, Australia Pignatti, U Verona, Italy
Edwards, Oxford, England Ramsay, SAMIR, South Africa
Efremov, Skopje, Yugoslavia Richards, GeneScreen, USA
Elles, St Mary's-Manchester, England Romeo, Gaslini-Genoa, Italy
Erlich, Cetus, USA Rowley, Rochester, USA
Estivill, Barcelona, Spain Rozen, Montreal Children, Canada
Ferec, Brest, France Scheffer,UGroningen,The Netherlands
Ferrari, Milano, Italy Schmidtke, IHG, Berlin
Gerard, Harvard, USA Schwartz, U Copenhagen, Denmark
Gilbert, Cornell, New York, USA Sebastio, Naples, Italy
Godet, Villeurbanna, France Seltzer, U Colorado, USA
Goossens, Creteil, France Spona, Vienna, Austria
Graham, Belfast, N Ireland Super, Royal Manchester, England
Halley, Rotterdam, The Netherlands Thibodeau, Rochester, USA
Harris, Guy's-London, England Tümmler, Hannova, West Germany
Higgins, Birmingham, England Verellen-Dumoulin,Bruxelles,Belgium
Highsmith, NC Mem Hosp, USA Willems, U Antwerp, Belgium
Hood, California Inst Tech, USA Williamson,St Mary'sLondon,England
Horst, Münster, West Germany
_____________________________________________________________
FROM: LAP-CHEE TSUI TOTAL NUMBER OF PAGES: 10
_____________________________________________________________
NEWSLETTER #25, August 30, 1990
_____________________________________________________________
1. A list of new mutations and variations:
a. Goossens M, Fanan P, Ghanem N, and Vidaud M report 2 mutations in exon 9 (3732delA and K1200E), 2 sequence variations in exon 12 (1816G->A for V562I, 1859G->C for G576A) and 1 variation in exon 19 (3617G->T for R1162L). Since the two exon 9 mutations were found on the same CF chromosome, they represent just one allele (see letter).
b. Nunes V and Estivill X report a sequence variation (873C->T) in exon 6a; they also note an error in their previous report where the intron sequence variation should read 290+12C->T (not 372+12C->T) (see letter).
c. Highsmith WE, Strong T, Burch N, Silverman LM, Collins FS, Boucher RC and Knowles MR report a (probable) splicing mutation for exon 14b (2751+5G->A). Please refer to their letter for details.
d. Bozon D, Zielenski J, Rininsland F, Rommens J and Tsui L-C: L1077P, a T to C change at nucleotide position 3362. The change was found in Toronto family #55. The mutation is on the maternal chromosome with haplotype IIIc. It can be detected by ASO hybridization, with the N sequence: TGA AAC TCT GTT CCA C and the CF sequence:TGA AAC TCC GTT CCA C. Genomic DNA may be amplified with 17bi-5 and 17bi-3. Temp for hybridization 37[[ring]]; final washing temp is 42[[ring]] in 2x SSC. We did not find this mutation in 27 other CF chromosomes (9 from group III) nor in 27 N chromosome (16 from group III).
2. There were a number of errors in a previous printout of the CFTR genomic DNA sequence (Newsletter #22).
a. Exon 3- a space should be inserted in the third line, between codon TTC and TAT;
b. Exon 10- there should be no space between TTTTA and TTTCC in the second line and the following sequence:
TGAACCCTTCACACTACCCAAATTATATATT
should be inserted between TTATGCATA and TGGCTCCAT in the fifth line; the PCR product should be 491 bp;
c. Exon 13- a space should be inserted between codon TTT and GTC;
d. in the list of PCR primers, 10D should read ACACGCCCTCCTCTTTCGTG;
6Ai-3 should read CTATGCATAGAGCAGTCCTG; an extra 4 bases (TCAA) was inserted in X13B-5 which should read TCAATCCAATCAACTCTATACGAA;
e. there are some errors in the sizes of the predicted PCR products; they should be 561 bp for exon 9, 449 for 14b, 579 for 17a, 463 for 17b, and 477 for 21;
f. there are several disagreement between the regions underlined and the PCR oligonucleotides shown in the table; please use the ones shown in the table.
We thank E. Edkins for noting some of the errors.
3. There are 2 pieces of technical information, from Chehab et al on the GATT repeat in front of exon 6b (originally reported by Horn et al) and, Schwarz and Super on R560T (Kerem et al. PNAS accepted) (see letters). Schwarz and Super also request clinical information for [[Delta]]I507.
4. For those members who have trouble receiving the previous Newsletters by FAX, you will receive them (issues #14-#25) in the mail by the middle of September. If you notice any mistakes in those issues, please drop me a note. If you want a copy of the compiled issues #1-#13, please also let me know.
5. Repeat announcement: A general meeting of the Consortium will be held at the next International CF Congress which will be held between October 3 and 6, 1990, in Arlington, Virginia, USA. The time of the meeting is tentatively scheduled for the evening of October 4; the exact time and location will be announced on a later date. The registration deadline for the Congress is September 5. Please call the US CF Foundation if you have any questions regarding registration to the Congress: (301) 951-4422; FAX number. (301) 951-6378.
Best regards,
Lap-Chee Tsui
Standardized population screening report to the consortium
From (Name of principal investigator): ___________________________
Patient population (Location / ethnic origin):
# CF chrom. # CF chrom.
Name Total (*) w/ mut'n Name Total (*) w/ mut'n
1. [[Delta]]F508 ______ ______ 31. Y913C ______ ______
2. [[Delta]]I507 ______ ______ 32. R553Q ______ ______
3. 2566insAT ______ ______ 33. S549R(A->C)______ ______
4. F508C (var?)______ ______ 34. P574H ______ ______
5. I506V (var) ______ ______ 35. 1154insTC ______ ______
6. G551D ______ ______ 36. 1214delT ______ ______
7. S549N ______ ______ 37. 3659delC ______ ______
8. R553X ______ ______ 38. 556delA ______ ______
9. A559T ______ ______ 39. 621+1G->T ______ ______
10. G542X ______ ______ 40. E1371X ______ ______
11. S549R(T->G)______ ______ 41. G85E ______ ______
12. R560T ______ ______ 42. R851X ______ ______
13. A455E ______ ______ 43. 711+1G->T ______ ______
14. Q493X ______ ______ 44. G179R ______ ______
15. R117H ______ ______ 45. 2909delT ______ ______
16. D110H ______ ______ 46. 2522insC ______ ______
17. R347P ______ ______ 47. R1162X ______ ______
18. S1255X ______ ______ 48. Q1291H ______ ______
19. W1282X ______ ______ 49. Q39X ______ ______
20. W1316X ______ ______ 50. G1244E ______ ______
21. 444delA ______ ______ 51. Y1092X ______ ______
22. 3821delT ______ ______ 52. 3662delA ______ ______
23. R334W ______ ______ 53. 1677delA ______ ______
24. S549I ______ ______ 54. V520F (?) ______ ______
25. G458V ______ ______ 55. 3732delA ______ ______
26. G1349D ______ ______ 56. 2751+5G->A______ ______
27. W846X ______ ______ ______ ______
28. 1717-1G->A______ ______ ______ ______
29. N1303K ______ ______ ______ ______
30. Y563N ______ ______ ______ ______
(*) In order to have a more useful number for comparison among the different populations, please include the number of [[Delta]]F508 screened for the non-[[Delta]]F508 mutations, even though you might not have done so.